life science research products, biological research products, biotechnology
Use * as wildcard:
miR-ID_microRNA_detection
realseq_ac
iclines

miR-ID® Detection Kit, cel-miR-39

miR-ID® Detection Kit, cel-miR-39
print page
Size: 100 x 20 µl reactions
$170.00
Add to basket
Catalogue number:
100-00012
Name:
miR-ID® Detection Kit, cel-miR-39
Supplier:
Availability:

miR-ID® microRNA Detection Kit (SYBR Green) for quantitation of miRNA from Total RNA. Kit includes Circularization Reaction Mix, RT primer, RT Reaction Mix, RT dilution Buffer, Nuclease-free Water, PCR primers.

Applications:

RT-qPCR assay for miRNA

Product Type:
Assays & kits
Additional Information:
miRNA SEQUENCE: UCACCGGGUGUAAAUCAGCUUG; mirBASE#: MIMAT0000010 (human); MIMAT0000010 (C.elegans)